Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762484

Xenopus ORFeome
What is the ORFeome?

ORF Name:emsy ORF1 Species: tropicalis
Gene Symbol: emsy Entrez Gene ID: 100136947
Gene Synonyms: c11orf30, gl002
Gene Name: EMSY, BRCA2-interacting transcriptional repressor
Description:
Plate: GDExt11044 Well: E09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136298.1
ORF Translation: ATO97650.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100136947, mRNA (cDNA clone MGC:121601 IMAGE:7622577), complete cds
Template Accession: BC135733
GI: 134025529
Clone ID: IMAGE:7622577
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCGGTGGTGTGGCCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGCAGTAGTTTGGCTGCTGA


Publications
First:
Most recent:
View All Papers