Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762514

Xenopus ORFeome
What is the ORFeome?

ORF Name:enpp4 ORF1 Species: tropicalis
Gene Symbol: enpp4 Entrez Gene ID: 550082
Gene Synonyms:
Gene Name: ectonucleotide pyrophosphatase/phosphodiesterase 4
Description: Type I phosphodiesterase/nucleotide pyrophosphatase
Plate: GDExt11029 Well: G11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135098.1
ORF Translation: ATO96450.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative function), mRNA (cDNA clone MGC:144963 IMAGE:7692075), complete cds
Template Accession: BC121205
GI: 111308928
Clone ID: IMAGE:7692075
Tissue: testis
Stage: frog
Clone Library: NIH_XGC_tropTe4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGGGAAGGGCTTTCATTGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCAATCAGAGGATCGTCA


Publications
First:
Most recent:
View All Papers