Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762519

Xenopus ORFeome
What is the ORFeome?

ORF Name:ensa ORF1 Species: tropicalis
Gene Symbol: ensa Entrez Gene ID: 407936
Gene Synonyms: alpha-endosulfine, arpp-19e, endosulfine alpha, ensa-a, ensa-b
Gene Name: endosulfine alpha
Description: Regulator of ATP-sensitive K+ channels Alpha-endosulfine/ARPP-19 and related cAMP-regulated phosphoproteins
Plate: GDExt11006 Well: D09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133225.1
ORF Translation: ATO94577.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis endosulfine alpha, mRNA (cDNA clone MGC:69262 IMAGE:5308162), complete cds
Template Accession: BC067944
GI: 45708825
Clone ID: IMAGE:5308162
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGATAAATACATTGGCGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACCTGGTGCAAGTCCTC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556