Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762624

Xenopus ORFeome
What is the ORFeome?

ORF Name:erf ORF1 Species: tropicalis
Gene Symbol: erf Entrez Gene ID: 548538
Gene Synonyms:
Gene Name: ETS2 repressor factor
Description: transcription factor
Plate: GDExt11021 Well: C07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134404.1
ORF Translation: ATO95756.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis Ets2 repressor factor, mRNA (cDNA clone MGC:97660 IMAGE:6980945), complete cds
Template Accession: BC090103
GI: 59807589
Clone ID: IMAGE:6980945
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAACCCCGGCAGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAATCCCGGTTTTCCAG


Publications
First:
Most recent:
View All Papers