Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762694

Xenopus ORFeome
What is the ORFeome?

ORF Name:etv3 ORF1 Species: tropicalis
Gene Symbol: etv3 Entrez Gene ID: 100036677
Gene Synonyms: mgc53585
Gene Name: ETS variant transcription factor 3
Description: transcription factor
Plate: GDExt11032 Well: G08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135339.1
ORF Translation: ATO96691.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis ets variant gene 3, mRNA (cDNA clone MGC:145286 IMAGE:7663193), complete cds
Template Accession: BC128620
GI: 118763659
Clone ID: IMAGE:7663193
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAACTGGCTGTAGCATTGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAATCAGCCACAGCAGCCA


Publications
First:
Most recent:
View All Papers