Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19762806

Xenopus ORFeome
What is the ORFeome?

ORF Name:fabp7 ORF1 Species: tropicalis
Gene Symbol: fabp7 Entrez Gene ID: 548661
Gene Synonyms: blbp, brain lipid binding protein
Gene Name: fatty acid binding protein 7, brain
Description: Fatty acid-binding protein FABP
Plate: GDExt11042 Well: B11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136110.1
ORF Translation: ATO97462.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC548661, mRNA (cDNA clone MGC:122022 IMAGE:7607727), complete cds
Template Accession: BC135436
GI: 134025800
Clone ID: IMAGE:7607727
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTAGATGTCTTCTGTGC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCCTTCTCATACTGACGAAC


Publications
First:
Most recent:
View All Papers