Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763220

Xenopus ORFeome
What is the ORFeome?

ORF Name:fgf8 ORF1 Species: tropicalis
Gene Symbol: fgf8 Entrez Gene ID: 493525
Gene Synonyms: aigf, fgf-8, fgf-8b, fgf8a, fgf8b, mgc79739, xfgf-8, xfgf8
Gene Name: fibroblast growth factor 8
Description: heparin-binding growth factor
Plate: GDExt11013 Well: E02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133689.1
ORF Translation: ATO95041.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis fibroblast growth factor 8 (androgen-induced), mRNA (cDNA clone MGC:79739 IMAGE:6983047), complete cds
Template Accession: BC082344
GI: 51949975
Clone ID: IMAGE:6983047
Tissue: whole organism
Stage: NF stage 40 to NF stage 45
Clone Library: NICHD_XGC_Emb8
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTACATCACCTCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCGAGAACTTGAGTATCGAG


Publications
First:
Most recent:
View All Papers