Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763235

Xenopus ORFeome
What is the ORFeome?

ORF Name:fgfr1op2 ORF1 Species: tropicalis
Gene Symbol: fgfr1op2 Entrez Gene ID: 448596
Gene Synonyms:
Gene Name: FGFR1 oncogene partner 2
Description: chromosome condensation complex component
Plate: GDExt11018 Well: G01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134166.1
ORF Translation: ATO95518.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis FGFR1 oncogene partner 2, mRNA (cDNA clone MGC:89199 IMAGE:7016990), complete cds
Template Accession: BC076932
GI: 49900184
Clone ID: IMAGE:7016990
Tissue: whole organism
Stage: frog
Clone Library: NICHD_XGC_Swb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTGTACCATAGAGAAGGTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTTTCCTTAAGCTCAGGT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556