Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763260

Xenopus ORFeome
What is the ORFeome?

ORF Name:fignl1 ORF1 Species: tropicalis
Gene Symbol: fignl1 Entrez Gene ID: 100124890
Gene Synonyms:
Gene Name: fidgetin-like 1
Description: AAA+-type ATPase
Plate: GDExt11046 Well: C01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136423.1
ORF Translation: ATO97775.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100124890, mRNA (cDNA clone MGC:121714 IMAGE:7630542), complete cds
Template Accession: BC135671
GI: 134024393
Clone ID: IMAGE:7630542
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAAGTACCTGAAAGTAGTTTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTGCCACAACCAAATGTTT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556