Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763346

Xenopus ORFeome
What is the ORFeome?

ORF Name:foxc2 ORF1 Species: tropicalis
Gene Symbol: foxc2 Entrez Gene ID: 407875
Gene Synonyms: fd-4, fkh7, foxc2-a, foxc2-b, mfh-1, mfh1, xfd-4
Gene Name: forkhead box C2
Description: forkhead domain transcription factor
Plate: GDExt11007 Well: A05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133238.1
ORF Translation: ATO94590.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis forkhead box C2 (MFH-1, mesenchyme forkhead 1), mRNA (cDNA clone MGC:69302 IMAGE:5308620), complete cds
Template Accession: BC067916
GI: 45709774
Clone ID: IMAGE:5308620
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAGGCGCGTTACTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACTTAGTGCAGTCGTAGG


Publications
First:
Most recent:
View All Papers