Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763351

Xenopus ORFeome
What is the ORFeome?

ORF Name:foxd1 ORF1 Species: tropicalis
Gene Symbol: foxd1 Entrez Gene ID: 493510
Gene Synonyms: bf-2, mgc89744, xbf-2, xbf2, xenopus brain factor 2
Gene Name: forkhead box D1
Description: forkhead domain transcription factor
Plate: GDExt11005 Well: B10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133065.1
ORF Translation: ATO94417.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis forkhead box D1, mRNA (cDNA clone MGC:89744 IMAGE:7027214), complete cds
Template Accession: BC081361
GI: 51703782
Clone ID: IMAGE:7027214
Tissue: whole organism
Stage:
Clone Library: XtSt10-30
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCTGAGCTCTGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGTTTGTAAGCACCGTC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556