Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763372

Xenopus ORFeome
What is the ORFeome?

ORF Name:foxi4.2 ORF1 Species: tropicalis
Gene Symbol: foxi4.2 Entrez Gene ID: 394878
Gene Synonyms: foxi1a, foxi4.2-a, foxi4.2-b, foxia, xfd2, xfoxi1, xfoxi1a, xlfox1a
Gene Name: forkhead box I4, gene 2
Description: forkhead domain transcription factor
Plate: GDExt11002 Well: F05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132816.1
ORF Translation: ATO94168.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis forkhead box I4, gene 2, mRNA (cDNA clone MGC:76222 IMAGE:5336445), complete cds
Template Accession: BC064241
GI: 39795837
Clone ID: IMAGE:5336445
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACCCAGTCCAGCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTACCTTCCCTGGTACAA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556