Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763398

Xenopus ORFeome
What is the ORFeome?

ORF Name:foxn3 ORF1 Species: tropicalis
Gene Symbol: foxn3 Entrez Gene ID: 549054
Gene Synonyms: checkpoint suppressor 1, ches1, foxn3-a, foxn3-b
Gene Name: forkhead box N3
Description: forkhead domain transcription factor
Plate: GDExt11048 Well: B01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136546.1
ORF Translation: ATO97898.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis forkhead box N3, mRNA (cDNA clone MGC:146956 IMAGE:7884840), complete cds
Template Accession: BC127344
GI: 117558610
Clone ID: IMAGE:7884840
Tissue: spleen
Stage:
Clone Library: NIH_XGC_tropSpl1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTCCAATCATGCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTTTTTGTGGTTTCTTTGTC


Publications
First:
Most recent:
View All Papers