Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763528

Xenopus ORFeome
What is the ORFeome?

ORF Name:fzd7 ORF1 Species: tropicalis
Gene Symbol: fzd7 Entrez Gene ID: 549495
Gene Synonyms: frizzled 7, frizzled-7, frizzled7, frz-7, frz7, fz-7, fz7, xfz7
Gene Name: frizzled class receptor 7
Description: transmembrane receptor in the wnt signaling pathway
Plate: GDExt11018 Well: D11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134267.1
ORF Translation: ATO95619.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis frizzled homolog 7, mRNA (cDNA clone MGC:69298 IMAGE:5308575), complete cds
Template Accession: BC090579
GI: 60618520
Clone ID: IMAGE:5308575
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCGCTACGGTCTCCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATACTGCAGTTTCCCCCTT


Publications
First:
Most recent:
View All Papers