Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763533

Xenopus ORFeome
What is the ORFeome?

ORF Name:fzd8 ORF1 Species: tropicalis
Gene Symbol: fzd8 Entrez Gene ID: 100038274
Gene Synonyms: frizzled 8, frizzled-8, frizzled8, fz-8, fz8, fzd8-a, fzd8-b, xfz8
Gene Name: frizzled class receptor 8
Description: transmembrane receptor in the Wnt signaling pathway
Plate: GDExt11040 Well: D10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135947.1
ORF Translation: ATO97299.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis frizzled homolog 8, mRNA (cDNA clone MGC:121288 IMAGE:7601319), complete cds
Template Accession: BC135224
GI: 134025355
Clone ID: IMAGE:7601319
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTGCCTGTACCTGCTGTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGAAAAAAACACGCCACCACGA


Publications
First:
Most recent:
View All Papers