Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763583

Xenopus ORFeome
What is the ORFeome?

ORF Name:gadd45a ORF1 Species: tropicalis
Gene Symbol: gadd45a Entrez Gene ID: 548905
Gene Synonyms: gadd
Gene Name: growth arrest and DNA damage inducible alpha
Description: 40S ribosomal protein S12
Plate: GDExt11034 Well: B09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135516.1
ORF Translation: ATO96868.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis growth arrest and DNA-damage-inducible, alpha, mRNA (cDNA clone MGC:146932 IMAGE:7710274), complete cds
Template Accession: BC121532
GI: 111309085
Clone ID: IMAGE:7710274
Tissue: intestine
Stage: frog
Clone Library: NIH_XGC_tropInt1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCTGGAGGAGCAGC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCGCTCTGGCAGGTTAAT


Publications
First:
Most recent:
View All Papers