Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763733

Xenopus ORFeome
What is the ORFeome?

ORF Name:gck ORF1 Species: tropicalis
Gene Symbol: gck Entrez Gene ID: 100124905
Gene Synonyms: glk, glucokinase, hexokinase 4, hhf3, hk4, hkiv, hxkp, mody2
Gene Name: glucokinase (hexokinase 4)
Description: Hexokinase
Plate: GDExt11046 Well: D01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136435.1
ORF Translation: ATO97787.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100124905, mRNA (cDNA clone MGC:121665 IMAGE:7626053), complete cds
Template Accession: BC135716
GI: 134026093
Clone ID: IMAGE:7626053
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAAAGTTTGAACAGAACGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGACCAATCAGGACAGCCAT


Publications
First:
Most recent:
View All Papers