Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763758

Xenopus ORFeome
What is the ORFeome?

ORF Name:gdf3 ORF1 Species: tropicalis
Gene Symbol: gdf3 Entrez Gene ID: 493288
Gene Synonyms: derriere, derrière, gdf-3, vgr-2, vgr2
Gene Name: growth differentiation factor 3
Description: tgf-beta related peptide growth factor
Plate: GDExt11011 Well: G08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133651.1
ORF Translation: ATO95003.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis derriere (tgf-beta family member), mRNA (cDNA clone MGC:79592 IMAGE:6979099), complete cds
Template Accession: BC080341
GI: 51512956
Clone ID: IMAGE:6979099
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTCTCACTCGCTTGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTGCAACCACATTCATCTACT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556