Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763773

Xenopus ORFeome
What is the ORFeome?

ORF Name:gem ORF1 Species: tropicalis
Gene Symbol: gem Entrez Gene ID: 100038040
Gene Synonyms: xgem
Gene Name: GTP binding protein overexpressed in skeletal muscle
Description: Ras-related GTPase
Plate: GDExt11047 Well: B09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136553.1
ORF Translation: ATO97905.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis GTP binding protein overexpressed in skeletal muscle, mRNA (cDNA clone MGC:147442 IMAGE:7805796), complete cds
Template Accession: BC121659
GI: 111308122
Clone ID: IMAGE:7805796
Tissue: fat body
Stage: frog
Clone Library: NIH_XGC_tropFat1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTTGAATGTGACCATGCGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGTACAGAGAGGTCATGGCAA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556