Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19763983

Xenopus ORFeome
What is the ORFeome?

ORF Name:gnas ORF2 Species: tropicalis
Gene Symbol: gnas Entrez Gene ID: 407931
Gene Synonyms: g alpha s, galphas, gas
Gene Name: GNAS complex locus
Description: G protein subunit Galphas, small G protein superfamily
Plate: GDExt11014 Well: E12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133913.1
ORF Translation: ATO95265.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis guanine nucleotide binding protein, alpha stimulating, olfactory type, mRNA (cDNA clone MGC:89360 IMAGE:6988120), complete cds
Template Accession: BC076953
GI: 49900223
Clone ID: IMAGE:6988120
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGTGTCTGGGCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAACAGCTCGTACTGGC


Publications
First:
Most recent:
View All Papers