Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19764228

Xenopus ORFeome
What is the ORFeome?

ORF Name:gpx7 ORF1 Species: tropicalis
Gene Symbol: gpx7 Entrez Gene ID: 779858
Gene Synonyms:
Gene Name: glutathione peroxidase 7
Description: Glutathione peroxidase
Plate: GDExt11035 Well: G01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135611.1
ORF Translation: ATO96963.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein MGC147250, mRNA (cDNA clone MGC:147250 IMAGE:7850007), complete cds
Template Accession: BC121615
GI: 113197884
Clone ID: IMAGE:7850007
Tissue: skeletal muscle
Stage: frog
Clone Library: NIH_XGC_tropSkeMus1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATCTAACAGCTCTTGTTCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGTTCCTCTTTCCTTTTCAGAAT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556