Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19764333

Xenopus ORFeome
What is the ORFeome?

ORF Name:gstt1 ORF1 Species: tropicalis
Gene Symbol: gstt1 Entrez Gene ID: 448525
Gene Synonyms:
Gene Name: glutathione S-transferase theta 1
Description: Glutathione S-transferase
Plate: GDExt11012 Well: D06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133670.1
ORF Translation: ATO95022.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis glutathione S-transferase theta 1, mRNA (cDNA clone MGC:79730 IMAGE:6982488), complete cds
Template Accession: BC076690
GI: 49898971
Clone ID: IMAGE:6982488
Tissue: whole organism
Stage: NF stage 40 to NF stage 45
Clone Library: NICHD_XGC_Emb8
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGCTCACACTGTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCATGGATAGTAACTTGGATTT


Publications
First:
Most recent:
View All Papers