Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19764463

Xenopus ORFeome
What is the ORFeome?

ORF Name:hand2 ORF1 Species: tropicalis
Gene Symbol: hand2 Entrez Gene ID: 100101704
Gene Synonyms: dhand, dhand2, hand2-a, hand2-b, xhand2
Gene Name: heart and neural crest derivatives expressed 2
Description: basic helix-loop-helix transcription factor
Plate: GDExt11045 Well: B01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136331.1
ORF Translation: ATO97683.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis heart and neural crest derivatives expressed 2, mRNA (cDNA clone MGC:121737 IMAGE:7631762), complete cds
Template Accession: BC135783
GI: 138519840
Clone ID: IMAGE:7631762
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCTGGTTGGGGGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGTTTAAGCTCCAGAGCC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556