Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19764484

Xenopus ORFeome
What is the ORFeome?

ORF Name:hba1 ORF1 Species: tropicalis
Gene Symbol: hba1 Entrez Gene ID: 394454
Gene Synonyms: alpha globin, alpha-globin, cd31, t3 globin
Gene Name: hemoglobin subunit alpha 1
Description: hemoglobin, oxygen transport
Plate: GDExt11026 Well: D07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134955.1
ORF Translation: ATO96307.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hemoglobin, alpha 1, mRNA (cDNA clone MGC:107925 IMAGE:7024463), complete cds
Template Accession: BC088005
GI: 56972254
Clone ID: IMAGE:7024463
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATCTTACAGCTGATGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACGATATTTGGATGTCAGAACATT


Publications
First:
Most recent:
View All Papers