Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19764766

Xenopus ORFeome
What is the ORFeome?

ORF Name:hoxa1 ORF1 Species: tropicalis
Gene Symbol: hoxa1 Entrez Gene ID: 493379
Gene Synonyms: bsas, hox1f, hoxa1-a, hoxa1-b, xhox.lab, xhox.lab2, xhoxa1
Gene Name: homeobox A1
Description: homeodomain transcription factor
Plate: GDExt11010 Well: C09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133581.1
ORF Translation: ATO94933.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis homeobox A1, mRNA (cDNA clone MGC:79507 IMAGE:6977173), complete cds
Template Accession: BC080895
GI: 51895943
Clone ID: IMAGE:6977173
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACTATGCGAGGATGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCGGAAGTACTGAGATGA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556