Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19764786

Xenopus ORFeome
What is the ORFeome?

ORF Name:hoxc8 ORF1 Species: tropicalis
Gene Symbol: hoxc8 Entrez Gene ID: 448482
Gene Synonyms: hoxc-8, xhoxc8
Gene Name: homeobox C8
Description: homeodomain transcription factor
Plate: GDExt11019 Well: A10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134331.1
ORF Translation: ATO95683.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis homeobox C8, mRNA (cDNA clone MGC:89609 IMAGE:6995191), complete cds
Template Accession: BC075597
GI: 49523090
Clone ID: IMAGE:6995191
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTCCTATTTTGTAAACCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCTTGCTCTCCTTGCT


Publications
First:
Most recent:
View All Papers