Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19764826

Xenopus ORFeome
What is the ORFeome?

ORF Name:hprt1 ORF1 Species: tropicalis
Gene Symbol: hprt1 Entrez Gene ID: 394936
Gene Synonyms: hgprt, hprt, prtfdc1
Gene Name: hypoxanthine phosphoribosyltransferase 1
Description: Hypoxanthine-guanine phosphoribosyltransferase
Plate: GDExt11002 Well: B07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG132807.1
ORF Translation: ATO94159.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypoxanthine phosphoribosyltransferase 1, mRNA (cDNA clone MGC:76223 IMAGE:5336463), complete cds
Template Accession: BC064242
GI: 39794424
Clone ID: IMAGE:5336463
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGAGTCCCTGCATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTTTTGTATTTTTCTTTACCATC


Publications
First:
Most recent:
View All Papers