Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19764896

Xenopus ORFeome
What is the ORFeome?

ORF Name:hspa1l ORF1 Species: tropicalis
Gene Symbol: hspa1l Entrez Gene ID: 779883
Gene Synonyms: hsp70
Gene Name: heat shock protein family A (Hsp70) member 1 like
Description: Molecular chaperones HSP70/HSC70, HSP70 superfamily
Plate: GDExt11035 Well: E06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135544.1
ORF Translation: ATO96896.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis heat shock 70kDa protein 1-like, mRNA (cDNA clone MGC:147483 IMAGE:7848086), complete cds
Template Accession: BC121673
GI: 111306224
Clone ID: IMAGE:7848086
Tissue: skeletal muscle
Stage: frog
Clone Library: NIH_XGC_tropSkeMus1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGAGCAAAGGGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTACCTCCTCAATAGTTGG


Publications
First:
Most recent:
View All Papers