Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19764936

Xenopus ORFeome
What is the ORFeome?

ORF Name:htra1 ORF1 Species: tropicalis
Gene Symbol: htra1 Entrez Gene ID: 780187
Gene Synonyms: high temperature required a1, prss11, xhtra1, xhtra1
Gene Name: HtrA serine peptidase 1
Description: serine protease
Plate: GDExt11039 Well: B12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135924.1
ORF Translation: ATO97276.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis HtrA serine peptidase 1, mRNA (cDNA clone MGC:145723 IMAGE:7793444), complete cds
Template Accession: BC125705
GI: 116487754
Clone ID: IMAGE:7793444
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGTGGCTGGCAGTGCTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAATTCTATTTCCTTGGGTGTCAC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556