Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19765177

Xenopus ORFeome
What is the ORFeome?

ORF Name:insm1 ORF1 Species: tropicalis
Gene Symbol: insm1 Entrez Gene ID: 779614
Gene Synonyms: ia1
Gene Name: insulinoma associated 1
Description: zinc finger transcription factor
Plate: GDExt11044 Well: A03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136291.1
ORF Translation: ATO97643.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis insulinoma-associated 1, mRNA (cDNA clone MGC:121580 IMAGE:7620294), complete cds
Template Accession: BC135650
GI: 134024376
Clone ID: IMAGE:7620294
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTAAAGGGTTTCTGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGGCCGGGCGCACCG


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556