Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19765232

Xenopus ORFeome
What is the ORFeome?

ORF Name:irf2 ORF1 Species: tropicalis
Gene Symbol: irf2 Entrez Gene ID: 493376
Gene Synonyms: irf-2
Gene Name: interferon regulatory factor 2
Description: transcription factor
Plate: GDExt11010 Well: C05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133558.1
ORF Translation: ATO94910.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis interferon regulatory factor 2, mRNA (cDNA clone MGC:79503 IMAGE:6977055), complete cds
Template Accession: BC080892
GI: 51703682
Clone ID: IMAGE:6977055
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCAGTAGAAAGGATGCGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAAGTTTTCAGCCTTGG


Publications
First:
Most recent:
View All Papers