Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19765283

Xenopus ORFeome
What is the ORFeome?

ORF Name:isy1 ORF1 Species: tropicalis
Gene Symbol: isy1 Entrez Gene ID: 394618
Gene Synonyms: fsap33
Gene Name: ISY1 splicing factor homolog
Description:
Plate: GDExt11010 Well: C02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133468.1
ORF Translation: ATO94820.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein MGC76019, mRNA (cDNA clone MGC:76019 IMAGE:5384697), complete cds
Template Accession: BC061420
GI: 38174131
Clone ID: IMAGE:5384697
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCGAAATGCAGAGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATATGCCTAGAAGTCGTTTTGCGT


Publications
First:
Most recent:
View All Papers