Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19765438

Xenopus ORFeome
What is the ORFeome?

ORF Name:kcnq4 ORF1 Species: tropicalis
Gene Symbol: kcnq4 Entrez Gene ID: 780386
Gene Synonyms: k(v)7.4, kv7.4
Gene Name: potassium channel, voltage gated KQT-like subfamily Q, member 4
Description: voltage-gated potassium channel activity
Plate: GDExt11029 Well: A06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135100.1
ORF Translation: ATO96452.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis potassium voltage-gated channel KQT-like protein 4, mRNA (cDNA clone MGC:146308 IMAGE:7691304), complete cds
Template Accession: BC121943
GI: 112419074
Clone ID: IMAGE:7691304
Tissue: testis
Stage: frog
Clone Library: NIH_XGC_tropTe4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTTTGTGGCCCTCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCATGTTGGTGCTGGCAGAA


Publications
First:
Most recent:
View All Papers