Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19765493

Xenopus ORFeome
What is the ORFeome?

ORF Name:keap1 ORF1 Species: tropicalis
Gene Symbol: keap1 Entrez Gene ID: 493386
Gene Synonyms: inrf2, klhl19
Gene Name: kelch like ECH associated protein 1
Description: Proteins containing BTB/POZ and Kelch domains, involved in regulatory/signal transduction processes
Plate: GDExt11011 Well: G01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133555.1
ORF Translation: ATO94907.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis keap1 protein, mRNA (cDNA clone MGC:79519 IMAGE:6977465), complete cds
Template Accession: BC080903
GI: 51703368
Clone ID: IMAGE:6977465
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTACGCGACAGAGTGCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTTTGGTGTGTGAAGAGAAGCA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556