Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19765633

Xenopus ORFeome
What is the ORFeome?

ORF Name:kmt5a ORF1 Species: tropicalis
Gene Symbol: kmt5a Entrez Gene ID: 780276
Gene Synonyms: setd8
Gene Name: lysine methyltransferase 5A
Description: Predicted methyltransferase (contains a SET domain)
Plate: GDExt11034 Well: D04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135476.1
ORF Translation: ATO96828.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis SET domain containing (lysine methyltransferase) 8, mRNA (cDNA clone MGC:147212 IMAGE:7826516), complete cds
Template Accession: BC121601
GI: 111309106
Clone ID: IMAGE:7826516
Tissue: ovary
Stage:
Clone Library: NIH_XGC_tropOva1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAGAGGGAAGAAAATG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTTTAAGCCAAGGATGTGCCTC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556