Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19765678

Xenopus ORFeome
What is the ORFeome?

ORF Name:krt24 ORF1 Species: tropicalis
Gene Symbol: krt55 Entrez Gene ID: 496660
Gene Synonyms: adult-specific keratin-b, krt5.l, xak-b
Gene Name: keratin 55
Description: Ankyrin repeat protein
Plate: GDExt11023 Well: G04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134629.1
ORF Translation: ATO95981.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis keratin 13, mRNA (cDNA clone MGC:108063 IMAGE:7003673), complete cds
Template Accession: BC087788
GI: 56556328
Clone ID: IMAGE:7003673
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Swb1N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTACAGTTCTGTGAAAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAGCGCTCGATCACCTCC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556