Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19765698

Xenopus ORFeome
What is the ORFeome?

ORF Name:krt8 ORF1 Species: tropicalis
Gene Symbol: krt8.1 Entrez Gene ID: 431676
Gene Synonyms: ck1, keratin8, krt8, xck1
Gene Name: keratin 8, gene 1
Description: fibrous structural protein
Plate: GDExt11018 Well: B10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134245.1
ORF Translation: ATO95597.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis keratin 8, mRNA (cDNA clone MGC:69490 IMAGE:5336297), complete cds
Template Accession: BC067939
GI: 62871667
Clone ID: IMAGE:5336297
Tissue: whole organism
Stage: NF stage 20 to NF stage 27
Clone Library: NICHD_XGC_Emb7
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTATCAAAACCACCAGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGTTTTGAGAAAACATCTGAGG


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556