Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19765793

Xenopus ORFeome
What is the ORFeome?

ORF Name:ldb1 ORF1 Species: tropicalis
Gene Symbol: ldb1 Entrez Gene ID: 407886
Gene Synonyms: clim2, nli, xldb1
Gene Name: LIM domain binding 1
Description: transcription cofactor
Plate: GDExt11006 Well: A11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133208.1
ORF Translation: ATO94560.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis LIM domain binding 1, mRNA (cDNA clone MGC:69250 IMAGE:5308070), complete cds
Template Accession: BC067989
GI: 45709732
Clone ID: IMAGE:5308070
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGGATCGAGATGTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGTGAAGCCTGTGAAGT


Publications
First:
Most recent:
View All Papers