Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19765818

Xenopus ORFeome
What is the ORFeome?

ORF Name:ldlrad3 ORF1 Species: tropicalis
Gene Symbol: ldlrad3 Entrez Gene ID: 100124916
Gene Synonyms:
Gene Name: low density lipoprotein receptor class A domain containing 3
Description:
Plate: GDExt11045 Well: E05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136357.1
ORF Translation: ATO97709.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100124916, mRNA (cDNA clone MGC:121730 IMAGE:7631388), complete cds
Template Accession: BC135753
GI: 134023950
Clone ID: IMAGE:7631388
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGCTCCTGTACCTGATCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACATCTACTTCTGTGCTTGG


Publications
First:
Most recent:
View All Papers