Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19766118

Xenopus ORFeome
What is the ORFeome?

ORF Name:lox ORF1 Species: tropicalis
Gene Symbol: lox Entrez Gene ID: 780067
Gene Synonyms: xlox
Gene Name: lysyl oxidase
Description: copper-dependent amine oxidase
Plate: GDExt11046 Well: A11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136452.1
ORF Translation: ATO97804.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis lysyl oxidase, mRNA (cDNA clone MGC:146507 IMAGE:7794343), complete cds
Template Accession: BC122993
GI: 114108243
Clone ID: IMAGE:7794343
Tissue: testis
Stage: frog
Clone Library: NIH_XGC_tropTe4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGTGCGCACTGGGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAAGGAGAAATTGTACAGCTGGA


Publications
First:
Most recent:
View All Papers