Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19766359

Xenopus ORFeome
What is the ORFeome?

ORF Name:mafk ORF1 Species: tropicalis
Gene Symbol: mafk Entrez Gene ID: 100036635
Gene Synonyms:
Gene Name: v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog K
Description: basic-leucine zipper (bZIP) transcription factor
Plate: GDExt11028 Well: H01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135042.1
ORF Translation: ATO96394.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis v-maf musculoaponeurotic fibrosarcoma oncogene homolog K, mRNA (cDNA clone MGC:146029 IMAGE:7676278), complete cds
Template Accession: BC127302
GI: 117558734
Clone ID: IMAGE:7676278
Tissue: testis
Stage:
Clone Library: NIH_XGC_tropTe3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACGACTAATCCCAAACCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATGCTGCAGAAAAAGGT


Publications
First:
Most recent:
View All Papers