Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19766539

Xenopus ORFeome
What is the ORFeome?

ORF Name:mbtd1 ORF1 Species: tropicalis
Gene Symbol: mbtd1 Entrez Gene ID: 448411
Gene Synonyms:
Gene Name: mbt domain containing 1
Description: Polycomb group protein SCM/L(3)MBT (tumor-supressor in Drosophila and humans)
Plate: GDExt11014 Well: B10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133883.1
ORF Translation: ATO95235.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis mbt domain containing 1, mRNA (cDNA clone MGC:89370 IMAGE:6988449), complete cds
Template Accession: BC075504
GI: 49522461
Clone ID: IMAGE:6988449
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAAAGACCAAGGATCTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGGTTCCTGTTTGATGTAATAGC


Publications
First:
Most recent:
View All Papers