Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19766674

Xenopus ORFeome
What is the ORFeome?

ORF Name:mef2d ORF1 Species: tropicalis
Gene Symbol: mef2d Entrez Gene ID: 780389
Gene Synonyms: mef2d-a, mef2d-b, sl-1, sl1, xmef2d
Gene Name: myocyte enhancer factor 2D
Description: MADS-box transcription factor
Plate: GDExt11032 Well: B02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135294.1
ORF Translation: ATO96646.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis myocyte enhancer factor 2D, mRNA (cDNA clone MGC:145245 IMAGE:7658934), complete cds
Template Accession: BC122909
GI: 114107990
Clone ID: IMAGE:7658934
Tissue: brain
Stage: frog
Clone Library: NIH_XGC_tropBrn3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAGGAAAAAGATCCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTCACCCATGCGTCGAG


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556