Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19766679

Xenopus ORFeome
What is the ORFeome?

ORF Name:meis2 ORF1 Species: tropicalis
Gene Symbol: meis2 Entrez Gene ID: 100036664
Gene Synonyms: mrg1
Gene Name: Meis homeobox 2
Description: homeodomain transcription factor
Plate: GDExt11036 Well: F07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135656.1
ORF Translation: ATO97008.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis Meis homeobox 2, mRNA (cDNA clone MGC:147307 IMAGE:7861852), complete cds
Template Accession: BC127368
GI: 117558112
Clone ID: IMAGE:7861852
Tissue: oviduct
Stage:
Clone Library: NIH_XGC_tropOvi1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGGAGTGGGGGTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACATATAGTGCCACTGCCC


Publications
First:
Most recent:
View All Papers