Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19766684

Xenopus ORFeome
What is the ORFeome?

ORF Name:meis3 ORF1 Species: tropicalis
Gene Symbol: meis3 Entrez Gene ID: 448474
Gene Synonyms: meis3-a, meis3-b, mrg2, xmeis3
Gene Name: Meis homeobox 3
Description: homeodomain transcription factor
Plate: GDExt11015 Well: F10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133957.1
ORF Translation: ATO95309.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis Meis homeobox 3, mRNA (cDNA clone MGC:89584 IMAGE:6994394), complete cds
Template Accession: BC075589
GI: 49523086
Clone ID: IMAGE:6994394
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCACAAAGGTATGATGAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGAGCGTGAATGTCTATGT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.13.1
Major funding for Xenbase is provided by grant P41 HD064556