Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19767586

Xenopus ORFeome
What is the ORFeome?

ORF Name:myf6 ORF1 Species: tropicalis
Gene Symbol: myf6 Entrez Gene ID: 549914
Gene Synonyms: herculin, mrf4, myf6-a, myf6-b, xmrf4, xmrf4-a, xmrf4a
Gene Name: myogenic factor 6
Description: myogenic helix-loop-helix transcription factor
Plate: GDExt11048 Well: G11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136651.1
ORF Translation: ATO98003.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis myogenic factor 6 (herculin), mRNA (cDNA clone MGC:180684 IMAGE:8907434), complete cds
Template Accession: BC153696
GI: 157423112
Clone ID: IMAGE:8907434
Tissue: tail
Stage: NF stage 55 to NF stage 66
Clone Library: NICHD_XGC_tropTail_m
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGGACCTATTTGAAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCTCTACCAGCTCCTGTAT


Publications
First:
Most recent:
View All Papers