Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19767636

Xenopus ORFeome
What is the ORFeome?

ORF Name:myod1 ORF1 Species: tropicalis
Gene Symbol: myod1 Entrez Gene ID: 394569
Gene Synonyms: mf25, myod, myod1-a, myod1-b, myogenic factor 3, xmyod, xtmyod
Gene Name: myogenic differentiation 1
Description: myogenic helix-loop-helix transcription factor
Plate: GDExt11004 Well: D08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133010.1
ORF Translation: ATO94362.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis myogenic differentiation 1, mRNA (cDNA clone MGC:75960 IMAGE:5384107), complete cds
Template Accession: BC061388
GI: 38174428
Clone ID: IMAGE:5384107
Tissue: whole organism
Stage: NF stage 14 to NF stage 19
Clone Library: NICHD_XGC_Emb6
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCTGTTGCCCCCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAAGACCTGGTAGATTGTGCTG


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556