Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19767721

Xenopus ORFeome
What is the ORFeome?

ORF Name:naif1 ORF1 Species: tropicalis
Gene Symbol: naif1 Entrez Gene ID: 549107
Gene Synonyms:
Gene Name: nuclear apoptosis inducing factor 1
Description: SNARE protein PEP12/VAM3/Syntaxin 7/Syntaxin 17
Plate: GDExt11040 Well: H03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG135913.1
ORF Translation: ATO97265.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC549107, mRNA (cDNA clone MGC:145022 IMAGE:7703057), complete cds
Template Accession: BC128614
GI: 124504223
Clone ID: IMAGE:7703057
Tissue: testis
Stage: frog
Clone Library: NIH_XGC_tropTe5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACGCCAGCCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGTTAATTCTATCCGATTGTC


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556