Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19767776

Xenopus ORFeome
What is the ORFeome?

ORF Name:ncam1 ORF1 Species: tropicalis
Gene Symbol: ncam1 Entrez Gene ID: 100038291
Gene Synonyms: n-cam, n-cam-1, ncam, ncam1-a, ncam1-b
Gene Name: neural cell adhesion molecule 1
Description: cell adhesion
Plate: GDExt11042 Well: B05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG136089.1
ORF Translation: ATO97441.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis hypothetical protein LOC100038291, mRNA (cDNA clone MGC:122050 IMAGE:7610303), complete cds
Template Accession: BC135314
GI: 134026171
Clone ID: IMAGE:7610303
Tissue: whole organism
Stage: NF stage 35 and 36 to NF stage 41
Clone Library: NIH_XGC_tropTad5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGCAAATTAAGGATCTCATC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTACTGACTGGCTGAGTAGTGA


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.2


Major funding for Xenbase is provided by grant P41 HD064556