Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19768142

Xenopus ORFeome
What is the ORFeome?

ORF Name:nif ORF1 Species: tropicalis
Gene Symbol: nif Entrez Gene ID: 448000
Gene Synonyms: ctdspl, xnif
Gene Name: low molecular weight neuronal intermediate filament
Description: cytoskeletal constituent
Plate: GDExt11006 Well: D08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133195.1
ORF Translation: ATO94547.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis low molecular weight neuronal intermediate filament, mRNA (cDNA clone MGC:69277 IMAGE:5308388), complete cds
Template Accession: BC074515
GI: 49250382
Clone ID: IMAGE:5308388
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTTCCAGAGAGCTCTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTGCTGCAGCTTTTTGAGGGGT


Publications
First:
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556